Review




Structured Review

Synthego Inc coding sequence targeting guide rna
Coding Sequence Targeting Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/guide+rna+sequence/bio_rxiv__64898__2026__05__05__723075-352-4-8
Average 86 stars, based on 1 article reviews
coding sequence targeting guide rna - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Sequencing:

Article Title: The reaction mechanism for glycolysis side product degradation by Parkinson’s disease–linked DJ-1
Article Snippet: .. The gRNA target sequence (5′-TAA GGT CAC CGT TGC AGG CC-3′) for DJ-1 exon three was designed using SYNTHEGO ( https://design.synthego.com/#/ ). ..

Article Title: The reaction mechanism for glycolysis side product degradation by Parkinson's disease-linked DJ-1.
Article Snippet: .. The gRNA target sequence (59-TAAGGT CACCGTTGCAGGCC-39) for DJ-1 exon three was designed using Watanabe et al. Journal of Cell Biology 16 of 21 Reactive lactone degradation by DJ-1/PARK7 https://doi.org/10.1083/jcb.202411078 D ow nloaded from http://rupress.org/jcb/article-pdf/224/8/e202411078/1945774/jcb_202411078.pdf by Viet N am user on 07 June 2025 SYNTHEGO (https://design.synthego.com/#/). ..



Similar Products

86
Benchling Inc optimal single guide rna sgrna target sequences
Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/guide+rna/pm42167230-305-5-14
Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc coding sequence targeting guide rna
Coding Sequence Targeting Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/guide+rna+sequence/bio_rxiv__64898__2026__05__05__723075-352-4-8
Average 86 stars, based on 1 article reviews
coding sequence targeting guide rna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rna sgrna sequences targeting fh
Single Guide Rna Sgrna Sequences Targeting Fh, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/sequences+sgrna/pm42082831-318-1-9
Average 86 stars, based on 1 article reviews
single guide rna sgrna sequences targeting fh - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Benchling Inc vero cells single guide rna sgrna sequences targeting dhhc11
Vero Cells Single Guide Rna Sgrna Sequences Targeting Dhhc11, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/guide+rnas+sgrnas+single+usp18/pm41223056-376-4-21
Average 86 stars, based on 1 article reviews
vero cells single guide rna sgrna sequences targeting dhhc11 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Addgene inc grna targeting sequence
Grna Targeting Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W+(Plasmid+%2367975)/pmc12589458-217-18-34
Average 93 stars, based on 1 article reviews
grna targeting sequence - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

86
Sangon Biotech single guide rna sgrna sequences targeting set8
Single Guide Rna Sgrna Sequences Targeting Set8, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/sequences+sirna/pm41029392-75-1-11
Average 86 stars, based on 1 article reviews
single guide rna sgrna sequences targeting set8 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc lrrk2 targeting grna sequence attgcaaagattgctgacta
Lrrk2 Targeting Grna Sequence Attgcaaagattgctgacta, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/attgcaaagattgctgacta+grna+lrrk2+sequence+targeting/pmc12436637-34-0-5
Average 86 stars, based on 1 article reviews
lrrk2 targeting grna sequence attgcaaagattgctgacta - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Synthego Inc grna target sequence
Grna Target Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequence/grna+sequences/pmc12135873-314-1-12
Average 90 stars, based on 1 article reviews
grna target sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results